The gto_amino_acid_from_fastq converts DNA sequences in the FASTQ file format to an amino acid sequence.
For help type:
./gto_amino_acid_from_fastq -h
In the following subsections, we explain the input and output paramters.
The gto_amino_acid_from_fastq program needs two streams for the computation, namely the input and output standard. The input stream is a FASTQ file.
The attribution is given according to:
Usage: ../../bin/gto_amino_acid_from_fastq [options] [[--] args]
or: ../../bin/gto_amino_acid_from_fastq [options]
It converts FASTQ file format to an amino acid sequence (translation).
-h, --help Show this help message and exit
Basic options
< input.fastq Input FASTQ file format (stdin)
> output.prot Output amino acid sequence file (stdout)
Optional
-f, --frame= Translation codon frame (1, 2 or 3)
Example: ../../bin/gto_amino_acid_from_fastq < input.fastq > output.prot
An example of such an input file is:
@SRR001666.1 071112_SLXA-EAS1_s_7:5:1:817:345 length=72
GGGTGATGGCCGCTGCCGATGGCGTCAAATCCCACCAAGTTACCCTTAACAACTTAAGGGTTTTCAAATAGA
+SRR001666.1 071112_SLXA-EAS1_s_7:5:1:817:345 length=72
IIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IG9ICIIIIIIIIIIIIIIIIIIIIDIIIIIII>IIIIII/
@SRR001666.2 071112_SLXA-EAS1_s_7:5:1:801:338 length=72
GTTCAGGGATACGACGTTTGTATTTTAAGAATCTGAAGCAGAAGTCGATGATAATACGCGTCGTTTTATCAT
+SRR001666.2 071112_SLXA-EAS1_s_7:5:1:801:338 length=72
IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII6IBIIIIIIIIIIIIIIIIIIIIIIIGII>IIIII-I)8I
The output of the gto_amino_acid_from_fastq program is an amino acid sequence.
Using the input above, an output example for this is the following:
G-WPLPMASNPTKLPLTT-GFSNRVQGYDVCILRI-SRSR--YASFYH