The gto_fastq_mutate creates a synthetic mutation of a FASTQ file given specific rates of mutations, deletions and additions. All these paramenters are defined by the user, and their are optional.
For help type:
./gto_fastq_mutate -h
In the following subsections, we explain the input and output paramters.
The gto_fastq_mutate program needs two streams for the computation, namely the input and output standard. However, optional settings can be supplied too, such as the starting point to the random generator, and the edition, deletion and insertion rates. Also, the user can choose to use the ACGTN alphabet in the synthetic mutation. The input stream is a FASTQ File.
The attribution is given according to:
Usage: ./gto_fastq_mutate [options] [[--] args]
or: ./gto_fastq_mutate [options]
Creates a synthetic mutation of a FASTQ file given specific rates of mutations,
deletions and additions
-h, --help show this help message and exit
Basic options
< input.fasta Input FASTQ file format (stdin)
> output.fasta Output FASTQ file format (stdout)
Optional
-s, --seed= Starting point to the random generator
-m, --mutation-rate= Defines the mutation rate (default 0.0)
-d, --deletion-rate= Defines the deletion rate (default 0.0)
-i, --insertion-rate= Defines the insertion rate (default 0.0)
-a, --ACGTN-alphabet When active, the application uses the ACGTN alphabet
Example: ./gto_fastq_mutate -s -m -d -i
-a < input.fastq > output.fastq
An example of such an input file is:
@SRR001666.1 071112_SLXA-EAS1_s_7:5:1:817:345 length=72
GGGTGATGGCCGCTGCCGATGGCGTCAAATCCCACCAAGTTACCCTTAACAACTTAAGGGTTTTCAAATAGA
+SRR001666.1 071112_SLXA-EAS1_s_7:5:1:817:345 length=72
IIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IG9ICIIIIIIIIIIIIIIIIIIIIDIIIIIII>IIIIII/
@SRR001666.2 071112_SLXA-EAS1_s_7:5:1:801:338 length=72
GTTCAGGGATACGACGTTTGTATTTTAAGAATCTGAAGCAGAAGTCGATGATAATACGCGTCGTTTTATCAT
+SRR001666.2 071112_SLXA-EAS1_s_7:5:1:801:338 length=72
IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII6IBIIIIIIIIIIIIIIIIIIIIIIIGII>IIIII-I)8I
The output of the gto_fastq_mutate program is a FASTQ file whith the synthetic mutation of input file.
Using the input above with the seed value as 1 and the mutation rate as 0.5, an output example for this is the following:
@SRR001666.1 071112_SLXA-EAS1_s_7:5:1:817:345 length=72
GGACTTTGAGGTGTGGCGATAGACTGAAAACACTTCAGGGTAAAATCACTCGCAAAAGTGCTATGGTTATGG
+SRR001666.1 071112_SLXA-EAS1_s_7:5:1:817:345 length=72
IIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IG9ICIIIIIIIIIIIIIIIIIIIIDIIIIIII>IIIIII/
@SRR001666.2 071112_SLXA-EAS1_s_7:5:1:801:338 length=72
GTTCAGAGCCTTTACCGTAGGGGTGTAAGATTTTATACAAAAAGTCCAGGTCAAGAGGAATCGGACAACCGA
+SRR001666.2 071112_SLXA-EAS1_s_7:5:1:801:338 length=72
IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII6IBIIIIIIIIIIIIIIIIIIIIIIIGII>IIIII-I)8I