The gto_fastq_to_mfasta onverts a FASTQ file format to a pseudo Multi-FASTA file. However, it does not align the sequence. Also, it extracts the sequence and adds a pseudo header.
For help type:
./gto_fastq_to_mfasta -h
In the following subsections, we explain the input and output paramters.
The gto_fastq_to_mfasta program needs two streams for the computation, namely the input and output standard. The input stream is a FASTQ file.
The attribution is given according to:
Usage: ./gto_fastq_to_mfasta [options] [[--] args]
or: ./gto_fastq_to_mfasta [options]
It converts a FASTQ file format to a pseudo Multi-FASTA file.
It does NOT align the sequence.
It extracts the sequence and adds each header in a Multi-FASTA format.
-h, --help show this help message and exit
Basic options
< input.fastq Input FASTQ file format (stdin)
> output.mfasta Output Multi-FASTA file format (stdout)
Example: ./gto_fastq_to_mfasta < input.fastq > output.mfasta
An example of such an input file is:
@SRR001666.1 071112_SLXA-EAS1_s_7:5:1:817:345 length=72
GGGTGATGGCCGCTGCCGATGGCGTCAAATCCCACCAAGTTACCCTTAACAACTTAAGGGTTTTCAAATAGA
+SRR001666.1 071112_SLXA-EAS1_s_7:5:1:817:345 length=72
IIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IG9ICIIIIIIIIIIIIIIIIIIIIDIIIIIII>IIIIII/
@SRR001666.2 071112_SLXA-EAS1_s_7:5:1:801:338 length=72
GTTCAGGGATACGACGTTTGTATTTTAAGAATCTGAAGCAGAAGTCGATGATAATACGCGTCGTTTTATCAT
+SRR001666.2 071112_SLXA-EAS1_s_7:5:1:801:338 length=72
IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII6IBIIIIIIIIIIIIIIIIIIIIIIIGII>IIIII-I)8I
The output of the gto_fastq_to_mfasta program a Multi-FASTA file.
Using the input above, an output example for this is the following:
>SRR001666.1 071112_SLXA-EAS1_s_7:5:1:817:345 length=72
GGGTGATGGCCGCTGCCGATGGCGTCAAATCCCACCAAGTTACCCTTAACAACTTAAGGGTTTTCAAATAGA
>SRR001666.2 071112_SLXA-EAS1_s_7:5:1:801:338 length=72
GTTCAGGGATACGACGTTTGTATTTTAAGAATCTGAAGCAGAAGTCGATGATAATACGCGTCGTTTTATCAT