The gto_info gives the basic properties of the file, namely size, cardinality, distribution percentage of the symbols, among others.
For help type:
./gto_info -h
In the following subsections, we explain the input and output paramters.
The gto_info program needs two streams for the computation, namely the input and output standard. The input stream is a file withou any specific format.
The attribution is given according to:
Usage: ./gto_info [options] [[--] args]
or: ./gto_info [options]
It gives the basic properties of the file, namely size, cardinality, distribution
percentage of the symbols, among others.
-h, --help show this help message and exit
Basic options
< input Input file (stdin)
> output Output read information (stdout)
Optional
-a, --ascii When active, the application shows the ASCII codes
Example: ./gto_info < input > output
Output example :
Number of symbols : value
Alphabet size : value
Alphabet : value
Symbol distribution:
An example of such an input file is:
>AB000264 |acc=AB000264|descr=Homo sapiens mRNA
ACAAGACGGCCTCCTGCTGCTGCTGCTCTCCGGGGCCACGGCCCTGGAGGGTCCACCGCTGCCCTGCTGCCATTGTCCCC
GGCCCCACCTAAGGAAAAGCAGCCTCCTGACTTTCCTCGCTTGGGCCGAGACAGCGAGCATATGCAGGAAGCGGCAGGAA
GTGGTTTGAGTGGACCTCCGGGCCCCTCATAGGAGAGGAAGCTCGGGAGGTGGCCAGGCGGCAGGAAGCAGGCCAGTGCC
GCGAATCCGCGCGCCGGGACAGAATCTCCTGCAAAGCCCTGCAGGAACTTCTTCTGGAAGACCTTCTCCACCCCCCCAGC
TAAAACCTCACCCATGAATGCTCGCAACACGCAAGTTTAATTCGCAAGTTAGACCTGAACGGGAGGTGGCCACGCAAGTT
The output of the gto_info program is a set of information related to the file read.
Using the input above, an output example for this is the following:
Number of symbols : 453
Alphabet size : 28
Alphabet :|srponmiedcaTRNHGCBA>=6420 \n
Symbol distribution:
| : 2 0.4415011
s : 3 0.66225166
r : 1 0.22075055
p : 1 0.22075055
o : 2 0.4415011
n : 1 0.22075055
m : 2 0.4415011
i : 1 0.22075055
e : 2 0.4415011
d : 1 0.22075055
c : 3 0.66225166
a : 2 0.4415011
T : 66 14.569536
R : 1 0.22075055
N : 1 0.22075055
H : 1 0.22075055
G : 117 25.827815
C : 131 28.918322
B : 2 0.4415011
A : 89 19.646799
> : 1 0.22075055
= : 2 0.4415011
6 : 2 0.4415011
4 : 2 0.4415011
2 : 2 0.4415011
0 : 6 1.3245033
: 4 0.88300221
\n : 5 1.1037528