The gto_genomic_count_bases counts the number of bases in sequence, FASTA or FASTQ files.
For help type:
./gto_genomic_count_bases -h
In the following subsections, we explain the input and output paramters.
The gto_genomic_count_bases program needs two streams for the computation, namely the input and output standard. The input stream is a sequence, FASTA or FASTQ file.
The attribution is given according to:
Usage: ./gto_genomic_count_bases [options] [[--] args]
or: ./gto_genomic_count_bases [options]
It counts the number of bases in sequence, FASTA or FASTQ files.
-h, --help Show this help message and exit
Basic options
< input Input sequence, FASTA or FASTQ file format (stdin)
> output Output read information (stdout)
Example: ./gto_genomic_count_bases < input.seq > output
Output example :
File type : value
Number of bases : value
Number of a/A : value
Number of c/C : value
Number of g/G : value
Number of t/T : value
Number of n/N : value
Number of others : value
An example of such an input file is:
TCTTTACTCGCGCGTTGGAGAAATACAATAGTGCGGCTCTGTCTCCTTATGAAGTCAACAATTTCGCTGGGACTTGCGGC
TCTTTACTCGCGCGTTGGAGAAATACAATAGTGCGGCTCTGTCTCCTTATGAAGTCAACAATTTCGCTGGGACTTGCGGC
GACTTCATCGTGGTCTCTGTCATTATGCGCTCCAACGCATAACTTTGCGCCAGAAGATAGATAGAATGGTGTAAGAAACT
GTAATATATATAATGAACTTCGGCGAGTCTGTGGAGTTTTTGTTGCATTAGAGAGCCAAGAGGTCGGACGTCCTCACGTA
GCCCGAGACGGGCAGGGCGATGGCGACTGAACGGGCTCCATATCACTTTGAGCTTTTATGCTTTCGACTCCTCCAGGAGC
TGAACAACCTTGTTCCCGGCAAAGCCCACTGCGTCATGGAGCTCACGGTCTACATTCATGACTGACTAACCGTAAACTGC
The output of the gto_genomic_count_bases program is report which describes the number of each base in the file, and the file type.
Using the input above, an output example for this is the following:
File type : DNA
Number of bases : 480
Number of a/A : 114
Number of c/C : 116
Number of g/G : 120
Number of t/T : 130
Number of n/N : 0
Number of others : 0