The gto_genomic_extract extracts sequences from a sequence file, which the range is defined by the user in the parameters.
For help type:
./gto_genomic_extract -h
In the following subsections, we explain the input and output paramters.
The gto_genomic_extract program needs two paramenters, which defines the begin and the end of the extraction, and two streams for the computation, namely the input and output standard. The input stream is a sequence file.
The attribution is given according to:
Usage: ./gto_genomic_extract [options] [[--] args]
or: ./gto_genomic_extract [options]
It extracts sequences from a sequence file.
-h, --help show this help message and exit
Basic options
-i, --init= The first position to start the extraction (default 0)
-e, --end= The last extract position (default 100)
< input.seq Input sequence file (stdin)
> output.seq Output sequence file (stdout)
Example: ./gto_genomic_extract -i -e < input.seq > output.seq
An example of such an input file is:
TCTTTACTCGCGCGTTGGAGAAATACAATAGTGCGGCTCTGTCTCCTTATGAAGTCAACAATTTCGCTGGGACTTGCGGC
TCTTTACTCGCGCGTTGGAGAAATACAATAGTGCGGCTCTGTCTCCTTATGAAGTCAACAATTTCGCTGGGACTTGCGGC
GACTTCATCGTGGTCTCTGTCATTATGCGCTCCAACGCATAACTTTGCGCCAGAAGATAGATAGAATGGTGTAAGAAACT
GTAATATATATAATGAACTTCGGCGAGTCTGTGGAGTTTTTGTTGCATTAGAGAGCCAAGAGGTCGGACGTCCTCACGTA
GCCCGAGACGGGCAGGGCGATGGCGACTGAACGGGCTCCATATCACTTTGAGCTTTTATGCTTTCGACTCCTCCAGGAGC
TGAACAACCTTGTTCCCGGCAAAGCCCACTGCGTCATGGAGCTCACGGTCTACATTCATGACTGACTAACCGTAAACTGC
The output of the gto_genomic_extract program is a group sequence.
Using the input above with the value 0 as the extraction starting point and the 50 as the ending, an output example for this is the following:
TCTTTACTCGCGCGTTGGAGAAATACAATAGTGCGGCTCTGTCTCCTTAT